9780198783688_Ch3

209

3.2 Genome organization and packaging

make up at least three per cent of the genome and consist of short nucleotide units, 14 base pairs or less in length, arranged in head to tail ‘tandem’ arrays, for example TTCCA/TTCCA/TTCCA repeated dozens or thousands of times. Such DNA sequences are found particularly around the centromeres (the region of the chromosome that attaches to the spindle at cell divi sion) and telomeres (ends of the chromosomes), but also at other places in the genome. The smallest repeat unit found is the dinucleotide repeat, for example CACACACA. These microsatellite sequences are found in multiple positions ( loci ) on the chromosomes and are polymorphic in that the num ber of repeats at any particular locus varies between individu als. This gives them some important practical applications, for example in forensic science where they are used in DNA profil ing, as described in Real World View 3.2.

Repetitive DNA in our genome can be classified according to whether it is derived from transposable elements. Two major types of retrotransposon-derived repeats are LINEs (long interspersed elements) and SINEs (short interspersed elements) . LINEs are a few thousand base pairs long and together make up around 21 per cent of the genome, while SINEs are 100–500 base pairs long and make up 13 per cent of the genome. The main class of SINEs is called the Alu element, of which there are more than one million in the genome. LINEs and SINEs are found as single or clustered sequences in many genomic locations, and comparison of their locations in different mammalian species suggests that they have proliferated and moved around relatively recently in our evolution ary history. However, the vast majority are no longer mobile. The other main category of repetitive DNAs, which are not transposon-derived, are termed simple sequence repeats . These

DNA profiling

REAL WORLD VIEW 3.2

Polymorphic microsatellite loci provide a method that can be used for forensic testing of DNA, perhaps at a crime scene or in paternity testing. The principle is illustrated in Figure 1, where details are shown only of

‘Locus 1’, a region of the genome where there is a microsatellite consisting of the sequence GATA repeated a variable number of times. Copies of the region are made using the polymerase chain reaction (PCR) which gives

Figure 1 Diagram illustrating the principle of DNA fingerprinting in forensic science. A microsatellite locus on homologous chromosomes of an individual is shown. PCR products give two bands, with the lower repeat number giving the smaller product that runs faster than the larger one. This process is repeated on several more selected loci on the DNA of the same individual so that altogether a pattern of bands will result that is unique to the individual. The process is repeated on the forensic sample of DNA to see if the patterns match. (Note that loci 2 and 3 are not illustrated but the bands that might be produced from them are shown.) Source : Snape, A. & Papachristodoulou, D. (2018). Biochemistry and Molecular Biology (6th ed.). Oxford University Press.

PCR primer

7 repeats

GATAGATAGATAGATAGATAGATAGATA CTATCTATCTATCTATCTATCTATCTAT

Locus 1

Two homologous chromosomes of an individual, one of paternal and one maternal origin.

2 repeats

GATAGATA CTATCTAT

PCR amplification of the chromosomal locus shown above will give bands on the acrylamide gel as shown in purple. This is repeated on up to 8 other loci of the same DNA using different primers.

Locus 1

(Locus 2)

(Locus 3)

Although only three loci are referred to, the combined results of PCR amplification from up to nine separate loci of an individual’s DNA gives a unique pattern of up to 18 bands, wich is highly discriminatory (All can be run on a single track).

7 repeats

2 repeats

© Oxford University Press